PTXB1-TN5 Plasmid - 2ug

https://gentaur-genprice.odoo.com/web/image/product.template/4447/image_1920?unique=204abc9

CAT #0820-PVT12233

996,15 € 996.15 EUR 996,15 €

996,15 €

Not Available For Sale

    Questa combinazione non esiste.

    Terms and Conditions
    Garanzia di rimborso di 30 giorni
    Spedizione: 2-3 giorni lavorativi

    pTXB1-Tn5 Information

    Promoter: T7

    Replicon: pUC

    Prokaryotic resistance: Amp

    Clonal strain: DH5a

    Culture conditions: LB/37 Centigrade

    Plasmid properties

    Vector host: Escherichia coli

    Carrier usage: Protein expression

    Gene species: Escherichia coli

    Gene type: ORF

    Prokaryotic resistance: Amp

     

    pTXB1-Tn5 Sequence

    ATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGCAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCCGAACGCCAGCAAGACGTAGCCCAGCGCGTCGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAG
    CTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCCGGCATGCCGCCCTTTCGTCTTCAAGAATTAATTCCCAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTGGGGATCGGAATTAATTCCCGGTTTAAACCGGGGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTAACTTTAAGAAGGAGATATACATATGATTACCAGTGCACTGCATCGTGCGGCGGATTGGGCGAAAAGCGTGTTTTCTAGTGCTGCGCTGGGTGATCCGCGTCGTACCGCGCGTCTGGTGAATGTTGCGGCGCAACTGGCCAAATATAGCGGCAAAAGCATTACCATTAGCAGCGAAGGCAGCAAAGCCATGCAGGAAGGCGCGTATCGTTTTATTCGTAATCCGAACGTGAGCGCGGAAGCGATTCGTAAAGCGGGTGCCATGCAGACCGTGAAACTGGCCCAGGAATTTCCGGAACTGCTGGCAATTGAAGATACCACCTCTCTGAGCTATCGTCATCAGGTGGCGGAAGAACTGGGCAAACTGGGTAGCATTCAGGATAAAAGCCGTGGTTGGTGGGTGCATAGCGTGCTGCTGCTGGAAGCGACCACCTTTCGTACCGTGGGCCTGCTGCATCAAGAA
    TGGTGGATGCGTCCGGATGATCCGGCGGATGCGGATGAAAAAGAAAGCGGCAAATGGCTGGCCGCTGCTGCAACTTCGCGTCTGAGAATGGGCAGCATGATGAGCAACGTGATTGCGGTGTGCGATCGTGAAGCGGATATTCATGCGTATCTGCAAGATAAACTGGCCCATAACGAACGTTTTGTGGTGCGTAGCAAACATCCGCGTAAAGATGTGGAAAGCGGCCTGTATCTGTATGATCACCTGAAAAACCAGCCGGAACTGGGCGGCTATCAGATTAGCATTCCGCAGAAAGGCGTGGTGGATAAACGTGGCAAACGTAAAAACCGTCCGGCGCGTAAAGCGAGCCTGAGCCTGCGTAGCGGCCGTATTACCCTGAAACAGGGCAACATTACCCTGAACGCGGTGCTGGCCGAAGAAATTAATCCGCCGAAAGGCGAAACCCCGCTGAAATGGCTGCTGCTGACCAGCGAGCCGGTGGAAAGTCTGGCCCAAGCGCTGCGTGTGATTGATATTTATACCCATCGTTGGCGCATTGAAGAATTTCACAAAGCGTGGAAAACGGGTGCGGGTGCGGAACGTCAGCGTATGGAAGAACCGGATAACCTGGAACGTATGGTGAGCATTCTGAGCTTTGTGGCGGTGCGTCTGCTGCAACTGCGTGAATCTTTTACTCCGCCGCAAGCACTGCGTGCGCAGGGCCTGCTGAAAGAAGCGGAACACGTTGAAAGCCAGAGCGCGGAAACCGTGCTGACCCCGGATGAATGCCAACTGCTGGGCTATCTGGATAAAGGCAAACGCAAACGCAAAGAAAAAGCGGGCAGCCTGCAATGGGCGTATATGGCGATTGCGCGTCTGGGCGGCTTTATGGATAGCAAACGTACCGGCATTGCGAGCTGGGGTGCGCTGTGGGAAGGTTGGGAAGCGCTGCAAAGCAAACTGGATGGCTTTCTGGCCGCGAAAGACCTGATGGCGCAGGGCATTAAAATCTGCATCACGGGAGATGCACTAGTTGCCCTACCCGAGGGCGAGTCGGTACGCATCGCCGACATCGTGCCGGGTGCGCGGCCCAACAGTGACAACGCCATCGACCTGAAAGTCCTTGACCGGCATGGCAATCCCGTGCTCGCCGACCGGCTGTTCCACTCCGGCGAGCATCCGGTGTACACGGTGCGTACGGTCGAAGGTCTGCGTGTGACGGGCACCGCGAACCACCCGTTGTTGTGTTTGGTCGACGTCGCCGGGGTGCCGACCCTGCTGTGGAAGCTGATCGACGAAATCAAGCCGGGCGATTACGCGGTGATTCAACGCAGCGCATTCAGCGTCGACTGTGCAGGTTTTGCCCGCGGGAAACCCGAATTTGCGCCCACAACCTACACAGTCGGCGTCCCTGGACTGGTGCGTTTCTTGGAAGCACACCACCGAGACCCGGACGCCCAA
    GCTATCGCCGACGAGCTGACCGACGGGCGGTTCTACTACGCGAAAGTCGCCAGTGTCACCGACGCCGGCGTGCAGCCGGTGTATAGCCTTCGTGTCGACACGGCAGACCACGCGTTTATCACGAACGGGTTCGTCAGCCACGCTACTGGCCTCACCGGTCTGAACTCAGGCCTCACGACAAATCCTGGTGTATCCGCTTGGCAGGTCAACACAGCTTATACTGCGGGACAATTGGTCACATATAACGGCAAGACGTATAAATGTTTGCAGCCCCACACCTCCTTGGCAGGATGGGAACCATCCAACGTTCCTGCCTTGTGGCAGCTTCAATGACTGCAGGAAGGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATAACTACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTCCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACCCCGGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTT
    TCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGA
    CCGAGCGCAGCGAGTCAGTGAGCGAGGAAGctatggtgcactctcagtacaatctgctctgatgccgcatagttaagcca

    gt
    //

     

    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
    3.  Shipping temperature is 2-8℃.