Skip to Content

PET28A- SUMO plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/6829/image_1920?unique=325b45d
(0 review)

0.00 € 0.0 EUR 0.00 € Tax Excluded

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Bacterial Resistance: Kanamycin

    Growth Strain: DH5α

    Expression: Bacterial

    Use: pET Plasmid

    Promoter: T7/lac

    Replicator: ColE1, ori, F1, ori

    Terminator: T7 Terminator

    Plasmid classification: Escherichia coli vector, PET series of expressed plasmids

    Plasmid size: 5633bp

    Plasmid labels: N-6 * His, N-Thrombin, N-SUMO, C-6 * His

    Prokaryotic resistance: kanamycin Kan

    Clone strain: DH5 alpha

    Culture conditions: 37 ℃, aerobic, LB

    Expression host: BL21 (DE3)

    Culture conditions: 37 ℃, aerobic, LB

    Induction: IPTG or lactose and its analogues


    Primers for 5'sequencing: T7: TAATACGACTCACTATAGGG

    Primers for 3'sequencing: T7-ter: TGCTAGTTATTGCTCAGCGG