Price List Default - EUR
  1. All Products
  2. icd-439F Forward Primer - 2x 250 nmol (Lyophilized)

icd-439F Forward Primer - 2x 250 nmol (Lyophilized)

https://www.gentaur.be/web/image/product.template/18590/image_1920?unique=b93a12c
(0 review)

Sequence (5' to 3'):
CGTTATTTTACGGGTGTGCCA

0.00 € 0.0 EUR 0.00 € VAT Excluded

142.00 € VAT Excluded

Not Available For Sale

    This combination does not exist.

    Contact Us For Price

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Sequence (5' to 3'):

    CGTTATTTTACGGGTGTGCCA