Hypothetical protein BG908_05820 201bp in pUC vector - 100ug plasmid + 200ul glycerol

(0 review)

370,00 € 370.0 EUR 370,00 € VAT Excluded

370,00 € VAT Excluded

Not Available For Sale

    Questa combinazione non esiste.

    Terms and Conditions
    Garanzia di rimborso di 30 giorni
    Spedizione: 2-3 giorni lavorativi

    DNA sequence: 

    RC46GOI: atgagaaattctacttataaacaaaacaaaatttttattttagcctatgttatatttggattgttcatgggtctattttttgacttattgttatcaactcacatatacacattaagtcttttaagtatattttttggcttttttatactaggagtaatctttaagattatcctttcatgccaaaataaaaaacatatttag

    Protein sequence: