pGEX-4T-3 Plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/7635/image_1920?unique=3213de2
(0 recensione)

0,00 € 0.0 EUR 0,00 € IVA esclusa

345,00 € IVA esclusa

info@gentaur.com

    Questa combinazione non esiste.

    Termini e condizioni
    Garanzia di rimborso di 30 giorni
    Spedizione: 2-3 giorni lavorativi

    pGEX-4T-3 Plasmid Information


    Alias: pgex4t3; pgex4t-3


    TAC: promoter


    Replicon: pBR322


    Plasmid classification: Escherichia coli vector; pGEX series expression plasmid


    Plasmid size: 4968 BP


    Plasmid Tags: n-gst, n-thrombin


    Prokaryotic resistance: amp


    Clone strain: dh5a


    Culture conditions: 37 degrees


    Expression host: E.coli BL21 (DE3)


    Culture conditions: 37 ℃, aerobic, lb


    Induction method: IPTG or lactose and its analogues


    5 'sequencing primer: pgex5: gggctggcaagccacgttgtggtg


    3 'sequencing primer: pgex3: ccggaggtgcatgtcagagg


    Note: GST affinity column can be used to purify recombinant protein


    Plasmid host: Escherichia coli


    Purpose of plasmid: protein expression


    Fragment type: ORF


    Fragment species: empty bodies


    Prokaryotic resistance: amp




    pGEX-4T-3 Plasmid Description


    pGEX-4T-3 plasmid is a 4968 bp E.coli Expression Vector, which can be connected to the target gene through the enzyme cutting site at MCS, and tac promoter starts GST promoting labeling and target gene fusion expression.