PCMV- DR8.91, 2 ug

(0 review)

436,00 € 436.0 EUR 436,00 € VAT Excluded

436,00 € VAT Excluded

Not Available For Sale

    Questa combinazione non esiste.

    Terms and Conditions
    Garanzia di rimborso di 30 giorni
    Spedizione: 2-3 giorni lavorativi


    PVT2323       2ug


    pCMV-dR8.91 Information

    Promoter: CMV, SP6
    Replicator: pUC, ori, SV40, ori
    Plasmid classification: viral series, lentivirus packaging vector
    Plasmid size: 12150bp
    Prokaryotic resistance: Amp
    Clone strain: Stbl3
    Culture conditions: 37 DEG C, aerobic LB
    Expression host: mammalian cells
    Induction mode: no induction, transient expression
    Primers for 5'sequencing: SP6:ATTTAGGTGACACTATAGAA
    Primers for 3'sequencing: primers were designed according to sequences


    pCMV-dR8.91 Description

    pCMV-dR8.91 is a lentivirus plasmid, size 12150bp with Amp Resistance.


    pCMV-dR8.91 Reference

    1. Generation of Luciferase-expressing Tumor Cell Lines

    Bio Protoc. 2018 Apr 20; 8(8): e2817. doi: 10.21769/BioProtoc.2817

    PMID: 29963584


    2. Article:  Mechanisms of autoregulation of C3G, activator of the GTPase Rap1, and its catalytic deregulation in lymphomas
    Arturo Carabias1,María Gómez-Hernández1,Sergio de Cima1, Antonio Rodríguez-Blázquez1, Alba Morán-Vaquero1, Patricia González-Sáenz1,Carmen Guerrero1,2, and José M. de Pereda1,

    Science Signaling  01 Sep 2020:
    Vol. 13, Issue 647, eabb7075
    DOI: 10.1126/scisignal.abb7075

    3.Article: Upregulation of Antioxidant Capacity and Nucleotide Precursor Availability Suffices for Oncogenic Transformation

    Author:YangZhang1YiXu1WenyunLu23Jonathan M.Ghergurovich24LiliGuo56Ian A.Blair5Joshua D.Rabinowitz23XiaoluYang17

    Received 22 January 2020, Revised 4 August 2020, Accepted 30 September 2020, Available online 6 November 2020.
    Published: November 6, 2020

    Cell Metabolism 
    Available online 6 November 2020 In Press

    doi: https://doi.org/10.1016/j.cmet.2020.10.002

    4. Article: TBL1XR1 Mutations Drive Extranodal Lymphoma by Inducing a Pro-tumorigenic Memory Fate

    Author: LeandroVenturutti1MattTeater1AndrewZhai2AmyChadburn3LeenaBabiker1DaleumKim1WendyBéguelin1Tak C.Lee1YoungjunKim4Christopher R.Chin15William T.Yewdell6BrianRaught7Jude M.Phillip1YanwenJiang1Louis M.Staudt8Michael R.Green910JayantaChaudhuri4611OlivierElemento12…Ari M.Melnick117

    Volume 182, Issue 2, 23 July 2020, Pages 297-316.e27
    Received 28 October 2019, Revised 24 March 2020, Accepted 27 May 2020, Available online 2 July 2020.
    Published: July 2, 2020

    5. Article:Functional genomic screening to unravel mechanisms underlying resistance to conventional induction therapy in T-cell acute lymphoblastic leukaemia

    Authors:     Beckett, Melanie

    Issue Date:     2020
    Publisher:     Newcastle University


    6. ARTICLE:MLL5 is involved in retinal photoreceptor maturation through facilitating CRXmediated photoreceptor gene transactivatio

    Authors:Xiaoming Zhang, Bo-Wen Zhang, Lue Xiang, Hui Wu, SUPIT Alva Sahiri Alexander,
    Peipei Zhou, Melvin Zi-Yu Dai, Xiaoyun Wang, Wenjun Xiong, Yan Zhang, Zi-Bing
    Jin, Lih-Wen Deng

    PII: S2589-0042(22)00328-5
    DOI: https://doi.org/10.1016/j.isci.2022.104058
    Reference: ISCI 104058
    To appear in: ISCIENCE
    Received Date: 23 August 2021
    Revised Date: 11 December 2021
    Accepted Date: 7 March 2022

    7. ARTICLE:Genome-Wide Knockout Screen Identifies Human Sialomucin CD164 as an Essential Entry Factor for Lymphocytic Choriomeningitis Virus

    Authors: Jamin Liu , Kristeene A. Knopp, Elze Rackaityte , Chung Yu Wang, Matthew T. Laurie, Sara Sunshine, Andreas S. Puschnik, Joseph L. DeRisi Email: joe@derisilab.ucsf.edu

    ASM Journals mBio

    8. ARTICLE:Understanding RNA viruses through functional genomics and next-generation sequencing techniques

    Liu, Chieh Ming JaminAdvisor(s): DeRisi, Joseph L

    pCMV-dR8.91 Sequences

    LOCUS       Exported               12150 bp ds-DNA     circular SYN 27-AUG-2016

    DEFINITION  synthetic circular DNA


    VERSION     .

    KEYWORDS    Untitled 31

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 12150)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported Saturday, August 27, 2016 from SnapGene Viewer 3.1.4

    FEATURES             Location/Qualifiers

         source          1..12150

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         promoter        377..580

                         /note="CMV promoter"

                         /note="human cytomegalovirus (CMV) immediate early 


         CDS             855..2357



                         /product="gag protein from human immunodeficiency virus 1"

                         /note="HIV-1 gag"










         CDS             2150..5161



                         /product="pol protein from human immunodeficiency virus 1"

                         /note="HIV-1 pol"



















         misc_feature    4846..4963


                         /note="central polypurine tract and central termination 

                         sequence of HIV-1"

         misc_feature    5735..5968


                         /note="The Rev response element (RRE) of HIV-1 allows for 

                         Rev-dependent mRNA export from the nucleus to the 


         promoter        complement(7140..7158)

                         /note="SP6 promoter"

                         /note="promoter for bacteriophage SP6 RNA polymerase"

         promoter        7946..8050


                         /note="AmpR promoter"

         CDS             8051..8911





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"







         rep_origin      9082..9670



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         promoter        9916..10245

                         /note="SV40 promoter"

                         /note="SV40 enhancer and early promoter"

         rep_origin      10096..10231

                         /note="SV40 ori"

                         /note="SV40 origin of replication"

         intron          11478..11543

                         /note="small t intron"

                         /note="simian virus 40 (SV40) small t antigen intron"

         CDS             11673..11693


                         /product="nuclear localization signal of SV40 large T 


                         /note="SV40 NLS"


         enhancer        12147..376

                         /note="CMV enhancer"

                         /note="human cytomegalovirus immediate early enhancer"


            1 ttgattattg actagttatt aatagtaatc aattacgggg tcattagttc atagcccata

           61 tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga

          121 cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt

          181 ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt

          241 gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca

          301 ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt

          361 catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt

          421 tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca

          481 ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg

          541 cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat

          601 cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag

          661 cctccgcggc cgggaacggt gcattggaac gcggattccc cgtgccaaga gtgacgtaag

          721 taccgcctat agagtctata ggcccacccc cttggcttct tatgcgacgg atcgatcccg

          781 taataagctt cgaggtccgc ggccggccgc gttgacgcgc acggcaagag gcgaggggcg

          841 gcgactggtg agagatgggt gcgagagcgt cagtattaag cgggggagaa ttagatcgat

          901 gggaaaaaat tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat

          961 gggcaagcag ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag

         1021 gctgtagaca aatactggga cagctacaac catcccttca gacaggatca gaagaactta

         1081 gatcattata taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag

         1141 acaccaagga agctttagac aagatagagg aagagcaaaa caaaagtaag aaaaaagcac

         1201 agcaagcagc agctgacaca ggacacagca atcaggtcag ccaaaattac cctatagtgc

         1261 agaacatcca ggggcaaatg gtacatcagg ccatatcacc tagaacttta aatgcatggg

         1321 taaaagtagt agaagagaag gctttcagcc cagaagtgat acccatgttt tcagcattat

         1381 cagaaggagc caccccacaa gatttaaaca ccatgctaaa cacagtgggg ggacatcaag

         1441 cagccatgca aatgttaaaa gagaccatca atgaggaagc tgcagaatgg gatagagtgc

         1501 atccagtgca tgcagggcct attgcaccag gccagatgag agaaccaagg ggaagtgaca

         1561 tagcaggaac tactagtacc cttcaggaac aaataggatg gatgacacat aatccaccta

         1621 tcccagtagg agaaatctat aaaagatgga taatcctggg attaaataaa atagtaagaa

         1681 tgtatagccc taccagcatt ctggacataa gacaaggacc aaaggaaccc tttagagact

         1741 atgtagaccg attctataaa actctaagag ccgagcaagc ttcacaagag gtaaaaaatt

         1801 ggatgacaga aaccttgttg gtccaaaatg cgaacccaga ttgtaagact attttaaaag

         1861 cattgggacc aggagcgaca ctagaagaaa tgatgacagc atgtcaggga gtggggggac

         1921 ccggccataa agcaagagtt ttggctgaag caatgagcca agtaacaaat ccagctacca

         1981 taatgataca gaaaggcaat tttaggaacc aaagaaagac tgttaagtgt ttcaattgtg

         2041 gcaaagaagg gcacatagcc aaaaattgca gggcccctag gaaaaagggc tgttggaaat

         2101 gtggaaagga aggacaccaa atgaaagatt gtactgagag acaggctaat tttttaggga

         2161 agatctggcc ttcccacaag ggaaggccag ggaattttct tcagagcaga ccagagccaa

         2221 cagccccacc agaagagagc ttcaggtttg gggaagagac aacaactccc tctcagaagc

         2281 aggagccgat agacaaggaa ctgtatcctt tagcttccct cagatcactc tttggcagcg

         2341 acccctcgtc acaataaaga taggggggca attaaaggaa gctctattag atacaggagc

         2401 agatgataca gtattagaag aaatgaattt gccaggaaga tggaaaccaa aaatgatagg

         2461 gggaattgga ggttttatca aagtaagaca gtatgatcag atactcatag aaatctgcgg

         2521 acataaagct ataggtacag tattagtagg acctacacct gtcaacataa ttggaagaaa

         2581 tctgttgact cagattggct gcactttaaa ttttcccatt agtcctattg agactgtacc

         2641 agtaaaatta aagccaggaa tggatggccc aaaagttaaa caatggccat tgacagaaga

         2701 aaaaataaaa gcattagtag aaatttgtac agaaatggaa aaggaaggaa aaatttcaaa

         2761 aattgggcct gaaaatccat acaatactcc agtatttgcc ataaagaaaa aagacagtac

         2821 taaatggaga aaattagtag atttcagaga acttaataag agaactcaag atttctggga

         2881 agttcaatta ggaataccac atcctgcagg gttaaaacag aaaaaatcag taacagtact

         2941 ggatgtgggc gatgcatatt tttcagttcc cttagataaa gacttcagga agtatactgc

         3001 atttaccata cctagtataa acaatgagac accagggatt agatatcagt acaatgtgct

         3061 tccacaggga tggaaaggat caccagcaat attccagtgt agcatgacaa aaatcttaga

         3121 gccttttaga aaacaaaatc cagacatagt catctatcaa tacatggatg atttgtatgt

         3181 aggatctgac ttagaaatag ggcagcatag aacaaaaata gaggaactga gacaacatct

         3241 gttgaggtgg ggatttacca caccagacaa aaaacatcag aaagaacctc cattcctttg

         3301 gatgggttat gaactccatc ctgataaatg gacagtacag cctatagtgc tgccagaaaa

         3361 ggacagctgg actgtcaatg acatacagaa attagtggga aaattgaatt gggcaagtca

         3421 gatttatgca gggattaaag taaggcaatt atgtaaactt cttaggggaa ccaaagcact

         3481 aacagaagta gtaccactaa cagaagaagc agagctagaa ctggcagaaa acagggagat

         3541 tctaaaagaa ccggtacatg gagtgtatta tgacccatca aaagacttaa tagcagaaat

         3601 acagaagcag gggcaaggcc aatggacata tcaaatttat caagagccat ttaaaaatct

         3661 gaaaacagga aagtatgcaa gaatgaaggg tgcccacact aatgatgtga aacaattaac

         3721 agaggcagta caaaaaatag ccacagaaag catagtaata tggggaaaga ctcctaaatt

         3781 taaattaccc atacaaaagg aaacatggga agcatggtgg acagagtatt ggcaagccac

         3841 ctggattcct gagtgggagt ttgtcaatac ccctccctta gtgaagttat ggtaccagtt

         3901 agagaaagaa cccataatag gagcagaaac tttctatgta gatggggcag ccaataggga

         3961 aactaaatta ggaaaagcag gatatgtaac tgacagagga agacaaaaag ttgtccccct

         4021 aacggacaca acaaatcaga agactgagtt acaagcaatt catctagctt tgcaggattc

         4081 gggattagaa gtaaacatag tgacagactc acaatatgca ttgggaatca ttcaagcaca

         4141 accagataag agtgaatcag agttagtcag tcaaataata gagcagttaa taaaaaagga

         4201 aaaagtctac ctggcatggg taccagcaca caaaggaatt ggaggaaatg aacaagtaga

         4261 taaattggtc agtgctggaa tcaggaaagt actattttta gatggaatag ataaggccca

         4321 agaagaacat gagaaatatc acagtaattg gagagcaatg gctagtgatt ttaacctacc

         4381 acctgtagta gcaaaagaaa tagtagccag ctgtgataaa tgtcagctaa aaggggaagc

         4441 catgcatgga caagtagact gtagcccagg aatatggcag ctagattgta cacatttaga

         4501 aggaaaagtt atcttggtag cagttcatgt agccagtgga tatatagaag cagaagtaat

         4561 tccagcagag acagggcaag aaacagcata cttcctctta aaattagcag gaagatggcc

         4621 agtaaaaaca gtacatacag acaatggcag caatttcacc agtactacag ttaaggccgc

         4681 ctgttggtgg gcggggatca agcaggaatt tggcattccc tacaatcccc aaagtcaagg

         4741 agtaatagaa tctatgaata aagaattaaa gaaaattata ggacaggtaa gagatcaggc

         4801 tgaacatctt aagacagcag tacaaatggc agtattcatc cacaatttta aaagaaaagg

         4861 ggggattggg gggtacagtg caggggaaag aatagtagac ataatagcaa cagacataca

         4921 aactaaagaa ttacaaaaac aaattacaaa aattcaaaat tttcgggttt attacaggga

         4981 cagcagagat ccagtttgga aaggaccagc aaagctcctc tggaaaggtg aaggggcagt

         5041 agtaatacaa gataatagtg acataaaagt agtgccaaga agaaaagcaa agatcatcag

         5101 ggattatgga aaacagatgg caggtgatga ttgtgtggca agtagacagg atgaggatta

         5161 acacatggaa ttctgcaaca actgctgttt atccatttca gaattgggtg tcgacatagc

         5221 agaataggcg ttactcgaca gaggagagca agaaatggag ccagtagatc ctagactaga

         5281 gccctggaag catccaggaa gtcagcctaa aactgcttgt accaattgct attgtaaaaa

         5341 gtgttgcttt cattgccaag tttgtttcat gacaaaagcc ttaggcatct cctatggcag

         5401 gaagaagcgg agacagcgac gaagagctca tcagaacagt cagactcatc aagcttctct

         5461 atcaaagcag taagtagtac atgtaatgca acctataata gtagcaatag tagcattagt

         5521 agtagcaata ataatagcaa tagttgtgtg gtccatagta atcatagaat ataggaaaat

         5581 ggccgctgat cttcagacct ggaggaggag atatgaggga caattggaga agtgaattat

         5641 ataaatataa agtagtaaaa attgaaccat taggagtagc acccaccaag gcaaagagaa

         5701 gagtggtgca gagagaaaaa agagcagtgg gaataggagc tttgttcctt gggttcttgg

         5761 gagcagcagg aagcactatg ggcgcagcgt caatgacgct gacggtacag gccagacaat

         5821 tattgtctgg tatagtgcag cagcagaaca atttgctgag ggctattgag gcgcaacagc

         5881 atctgttgca actcacagtc tggggcatca agcagctcca ggcaagaatc ctggctgtgg

         5941 aaagatacct aaaggatcaa cagctcctgg ggatttgggg ttgctctgga aaactcattt

         6001 gcaccactgc tgtgccttgg aatgctagtt ggagtaataa atctctggaa cagatttgga

         6061 atcacacgac ctggatggag tgggacagag aaattaacaa ttacacaagc ttaatacact

         6121 ccttaattga agaatcgcaa aaccagcaag aaaagaatga acaagaatta ttggaattag

         6181 ataaatgggc aagtttgtgg aattggttta acataacaaa ttggctgtgg tatataaaat

         6241 tattcataat gatagtagga ggcttggtag gtttaagaat agtttttgct gtactttcta

         6301 tagtgaatag agttaggcag ggatattcac cattatcgtt tcagacccac ctcccaaccc

         6361 cgaggggacc cgacaggccc gaaggaatag aagaagaagg tggagagaga gacagagaca

         6421 gatccattcg attagtgaac ggatccttgg cacttatctg ggacgatctg cggagcctgt

         6481 gcctcttcag ctaccaccgc ttgagagact tactcttgat tgtaacgagg attgtggaac

         6541 ttctgggacg cagggggtgg gaagccctca aatattggtg gaatctccta caatattgga

         6601 gtcaggagct aaagaatagt gctgttagct tgctcaatgc cacagccata gcagtagctg

         6661 aggggacaga tagggttata gaagtagtac aaggagcttg tagagctatt cgccacatac

         6721 ctagaagaat aagacagggc ttggaaagga ttttgctata agctcgaggc cgccccggtg

         6781 accttcagac cttggcactg gaggtggccc ggcagaagcg cggcatcgtg gatcagtgct

         6841 gcaccagcat ctgctctctc taccaactgg agaactactg caactaggcc caccactacc

         6901 ctgtccaccc ctctgcaatg aataaaacct ttgaaagagc actacaagtt gtgtgtacat

         6961 gcgtgcatgt gcatatgtgg tgcgggggga acatgagtgg ggctggctgg agtggcgatg

         7021 ataagctgtc aaacatgaga attaattctt gaagacgaaa gggcctcgtg atacgcctat

         7081 ttttataggt taatgtcatg ataataatgg tttcttagtc tagaattaat tccgtgtatt

         7141 ctatagtgtc acctaaatcg tatgtgtatg atacataagg ttatgtatta attgtagccg

         7201 cgttctaacg acaatatgta caagcctaat tgtgtagcat ctggcttact gaagcagacc

         7261 ctatcatctc tctcgtaaac tgccgtcaga gtcggtttgg ttggacgaac cttctgagtt

         7321 tctggtaacg ccgtcccgca cccggaaatg gtcagcgaac caatcagcag ggtcatcgct

         7381 agccagatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt

         7441 gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc

         7501 atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc

         7561 gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta

         7621 ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaatggt gcactctcag

         7681 tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga

         7741 cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc

         7801 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg

         7861 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc

         7921 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca

         7981 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa

         8041 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt

         8101 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca

         8161 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag

         8221 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc

         8281 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca

         8341 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt

         8401 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct

         8461 gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt

         8521 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga

         8581 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact

         8641 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc

         8701 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga

         8761 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt

         8821 agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga

         8881 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact

         8941 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga

         9001 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt

         9061 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca

         9121 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct

         9181 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta

         9241 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct

         9301 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc

         9361 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca

         9421 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga

         9481 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg

         9541 aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt

         9601 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag

         9661 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt

         9721 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt

         9781 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga

         9841 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta

         9901 atgcagctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc cccagcaggc

         9961 agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa gtccccaggc

        10021 tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac catagtcccg

        10081 cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat

        10141 ggctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc

        10201 cagaagtagt gaggaggctt ttttggaggc ctaggctttt gcaaaaagct tggacacaag

        10261 acaggcttgc gagatatgtt tgagaatacc actttatccc gcgtcaggga gaggcagtgc

        10321 gtaaaaagac gcggactcat gtgaaatact ggtttttagt gcgccagatc tctataatct

        10381 cgcgcaacct attttcccct cgaacacttt ttaagccgta gataaacagg ctgggacact

        10441 tcacatgagc gaaaaataca tcgtcacctg ggacatgttg cagatccatg cacgtaaact

        10501 cgcaagccga ctgatgcctt ctgaacaatg gaaaggcatt attgccgtaa gccgtggcgg

        10561 tctgtaccgg gtgcgttact ggcgcgtgaa ctgggtattc gtcatgtcga taccgtttgt

        10621 atttccagct acgatcacga caaccagcgc gagcttaaag tgctgaaacg cgcagaaggc

        10681 gatggcgaag gcttcatcgt tattgatgac ctggtggata ccggtggtac tgcggttgcg

        10741 attcgtgaaa tgtatccaaa agcgcacttt gtcaccatct tcgcaaaacc ggctggtcgt

        10801 ccgctggttg atgactatgt tgttgatatc ccgcaagata cctggattga acagccgtgg

        10861 gatatgggcg tcgtattcgt cccgccaatc tccggtcgct aatcttttca acgcctggca

        10921 ctgccgggcg ttgttctttt taacttcagg cgggttacaa tagtttccag taagtattct

        10981 ggaggctgca tccatgacac aggcaaacct gagcgaaacc ctgttcaaac cccgctttaa

        11041 acatcctgaa acctcgacgc tagtccgccg ctttaatcac ggcgcacaac cgcctgtgca

        11101 gtcggccctt gatggtaaaa ccatccctca ctggtatcgc atgattaacc gtctgatgtg

        11161 gatctggcgc ggcattgacc cacgcgaaat cctcgacgtc caggcacgta ttgtgatgag

        11221 cgatgccgaa cgtaccgacg atgatttata cgatacggtg attggctacc gtggcggcaa

        11281 ctggatttat gagtgggccc cggatctttg tgaaggaacc ttacttctgt ggtgtgacat

        11341 aattggacaa actacctaca gagatttaaa gctctaaggt aaatataaaa tttttaaccc

        11401 ggatctttgt gaaggaacct tacttctgtg gtgtgacata attggacaaa ctacctacag

        11461 agatttaaag ctctaaggta aatataaaat ttttaagtgt ataatgtgtt aaactactga

        11521 ttctaattgt ttgtgtattt tagattccaa cctatggaac tgatgaatgg gagcagtggt

        11581 ggaatgcctt taatgaggaa aacctgtttt gctcagaaga aatgccatct agtgatgatg

        11641 aggctactgc tgactctcaa cattctactc ctccaaaaaa gaagagaaag gtagaagacc

        11701 ccaaggactt tccttcagaa ttgctaagtt ttttgagtca tgctgtgttt agtaatagaa

        11761 ctcttgcttg ctttgctatt tacaccacaa aggaaaaagc tgcactgcta tacaagaaaa

        11821 ttatggaaaa atattctgta acctttataa gtaggcataa cagttataat cataacatac

        11881 tgttttttct tactccacac aggcatagag tgtctgctat taataactat gctcaaaaat

        11941 tgtgtacctt tagcttttta atttgtaaag gggttaataa ggaatatttg atgtatagtg

        12001 ccttgactag agatcataat cagccatacc acatttgtag aggttttact tgctttaaaa

        12061 aacctcccac acctccccct gaacctgaaa cataaaatga atgcaattgt tgttgttggg

        12121 ctgcaggaat taattcgagc tcgcccgaca


    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
    3.  Shipping temperature is 2-8℃.