Skip to Content
Price List Default - EUR
Avian Influenza H5 Antibody ELISA Kit, AIV H5 Ab ELISA Kit - 96 wells plate
Not Available For Sale 0.0 EUR
Avian Influenza H7 Antibody ELISA Kit, AIV H7 Ab ELISA Kit - 96 wells plate
Not Available For Sale 0.0 EUR
SH-PEG-CHO, 1K - 1 gram
Benzaldehyde-Polyethylene glycol-Thiol
Not Available For Sale 0.0 EUR
Meloxicam ELISA Kit - 96 wells plate
Assay type: Competitive inhibition
Sensitivity: 0.1 PPB (parts per billion)
Sample types: serum, plasma, tissue homogenates and other biological fluids
Not Available For Sale 0.0 EUR
SULF1 Antibody - 0.2 mL
Clonality: Polyclonal
Host: Rabbit
Formulation: 1X PBS, pH 7.4, with 0.09% sodium azide
Immunogen: 704-738 AA peptide fragment of the human SULF1
Not Available For Sale 0.0 EUR
Porcine Myoglobin Rapid Test Kit - 10 tests
Not Available For Sale 0.0 EUR
Human BMP2 (Bone Morphogenetic Protein 2) ELISA Kit - 96 wells plate
Not Available For Sale 0.0 EUR
Human reduced glutathione (rGSH) ELISA Kit - 96 wells plate
Not Available For Sale 0.0 EUR
Human KL-6 (Krebs Von den Lungen-6) ELISA Kit - 96-wells plate
Not Available For Sale 0.0 EUR
pEE6.4 Plasmid - 2 ug
Not Available For Sale 0.0 EUR
pEE12.4 Plasmid - 2 ug
Not Available For Sale 0.0 EUR
Recombinant Human Protein FAM19A4 (FAM19A4), C-terminal human IgG1 Fc with an LALAPG Fc silencing mutation, Mammalian expression - 100 ug
Uniprot: Q96LR4
Expression Region: 36-140 AA
Not Available For Sale 0.0 EUR
Recombinant Human Protein FAM19A4 (FAM19A4), C-terminal myc-His tag, Mammalian expression - 100 ug
Uniprot: Q96LR4
Expression Region: 36-140 AA
Not Available For Sale 0.0 EUR
Human Zinc Transporter 8 (ZNT8) ELISA Kit - 96-wells plate
Not Available For Sale 0.0 EUR
Babesia bovis Nested PCR primer (2nd reverse) - 100 nmol (Lyophilized)
Sequence:
CTACCGAGCAGAACCTTCTTCACCAT
Not Available For Sale 0.0 EUR
Babesia bovis Nested PCR primer (2nd forward) - 100 nmol (Lyophilized)
Sequence:
TCAACAAGGTACTCTATATGGCTACC
Not Available For Sale 0.0 EUR
Babesia bovis Nested PCR primer (1st reverse) - 100 nmol (Lyophilized)
Sequence:
CCAAGGACCTTCAACGTACGAGGTCA
Not Available For Sale 0.0 EUR
Babesia bovis Nested PCR primer (1st forward) - 100 nmol (Lyophilized)
Sequence:
CACGAGCAAGGAACTACCGATGTTGA
Not Available For Sale 0.0 EUR
Babesia bigemina PCR primer (reverse) - 100 nmol (Lyophilized)
Sequence:
CCTCAAAAGCAGATTCGGAGT
Not Available For Sale 0.0 EUR
Babesia bigemina PCR primer (forward) - 100 nmol (Lyophilized)
Sequence:
TACTGTGACGAGGACGGATC
Not Available For Sale 0.0 EUR